After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EBI3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005755.2
Размер кДНК:690bp
Описание кДНК:Full length Clone DNA of Homo sapiens Epstein-Barr virus induced 3 (EBI3) with N terminal His tag.
Синоним гена:IL27B, EBI3
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:pCMV3-His-EBI3
Участок рестрикции:HindIII + XbaI (6kb + 0.72kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human EBI3 Gene Plasmid Map
Human EBI3 / IL27b ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10117-ACGRBS15400
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10117-ACRRBS15400
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10117-CFRBS13340
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10117-CHRBS13340
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10117-CMRBS13340
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10117-CYRBS13340
Человек EBI3 / IL27b Джин клон кДНК в вектор клонированияHG10117-MRBS5130
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмидыHG10117-M-NRBS13340
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10117-NFRBS13340
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10117-NHRBS13340
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10117-NMRBS13340
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10117-NYRBS13340
Человек EBI3 / IL27b Джин ORF экспрессии кДНК клона плазмидыHG10117-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10117-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human EBI3 / IL27b ORF mammalian expression plasmid, N-His tag
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».