Быстрый заказ

Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EBAG9 Информация о продукте «Клон cDNA»
Размер кДНК:642bp
Описание кДНК:Full length Clone DNA of Homo sapiens estrogen receptor binding site associated, antigen, 9 with C terminal His tag.
Синоним гена:EB9, PDAF, RCAS1, EBAG9
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14012-ACGRBS15400
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14012-ACRRBS15400
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14012-CFRBS13340
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14012-CHRBS13340
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14012-CMRBS13340
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14012-CYRBS13340
Человек RCAS1 / EBAG9 Джин клон кДНК в вектор клонированияHG14012-GRBS5130
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14012-NFRBS13340
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14012-NHRBS13340
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14012-NMRBS13340
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14012-NYRBS13340
Человек RCAS1 / EBAG9 Джин ORF экспрессии кДНК клона плазмидыHG14012-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

RCAS1, also known as EBAG9, is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. RCAS1 gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor which binds to the estrogen-responsive element (ERE) found in the 5'-flanking region of RCAS1 gene. Two transcript variants differing in the 5' UTR, but encoding the same protein, have been identified for RCAS1 gene. EBAG9 may participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.

  • Ohshima K. et al., 2001, Clin Exp Immunol. 123 (3): 481-6.
  • Ikeda K. et al., 2000, Biochem Biophys Res Commun. 273 (2): 654-60.
  • Nakashima M. et al., 1999, Nat Med. 5 (8): 938-42.
  • Size / Price
    Каталог: HG14012-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.