Быстрый заказ

Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DKK1 Информация о продукте «Клон cDNA»
Размер кДНК:795bp
Описание кДНК:Full length Clone DNA of Homo sapiens dickkopf homolog 1 (Xenopus laevis) with N terminal Myc tag.
Синоним гена:SK, DKK-1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10170-ACGRBS15400
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10170-ACRRBS15400
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10170-CFRBS13340
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10170-CHRBS13340
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10170-CMRBS13340
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10170-CYRBS13340
Человек DKK1/Dkk-1 Джин клон кДНК в вектор клонированияHG10170-MRBS5130
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10170-NFRBS13340
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10170-NHRBS13340
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10170-NMRBS13340
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10170-NYRBS13340
Человек DKK1/Dkk-1 Джин ORF экспрессии кДНК клона плазмидыHG10170-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Dickkopf (DKK) family proteins, consisting of DKK-1, DKK-2, DKK-3 and DKK-4, function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5/6. DKK-1, DKK-2, and DKK-4 also bind cell surface Kremen-1 or Kremen-2 and promote the internalization of LRP5/6. Dickkopf related protein 1 (DKK-1) was initially identified as an inducer of head formation in Xenopus embryos. DKK-1 protein modulates Wnt signaling pathway during embryonic development. Increased levels of DKK-1 are found in the majority of lung cancers, esophageal squamous cell carcinomas, and hormone-resistant breast cancers, while DKK-1 expression is decreased in malignant melanoma and colorectal cancers.

  • Horwitz EM. (2004) Dkk-1-mediated expansion of adult stem cells. Trends Biotechnol. 22(8): 386-8.
  • Jiang T, et al. (2009) Clinical significance of serum DKK-1 in patients with gynecological cancer. Int J Gynecol Cancer. 19(7): 1177-81.
  • Size / Price
    Каталог: HG10170-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.