After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DSC2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_024422.3
Размер кДНК:2706bp
Описание кДНК:Full length Clone DNA of Homo sapiens desmocollin 2 with N terminal Myc tag.
Синоним гена:DG2, DSC3, CDHF2, ARVD11, DGII/III, DKFZp686I11137, DSC2
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10809-ACGRBS22240
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10809-ACRRBS22240
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10809-CFRBS20190
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10809-CHRBS20190
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10809-CMRBS20190
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10809-CYRBS20190
Человек DSC2 Джин клон кДНК в вектор клонированияHG10809-MRBS5130
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10809-NFRBS20190
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10809-NHRBS20190
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10809-NMRBS20190
Человек DSC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10809-NYRBS20190
Человек DSC2 Джин ORF экспрессии кДНК клона плазмидыHG10809-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

DSC2 is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. Like other desmocollins, murine DSC2 has two products, Dsc2a and Dsc2b, produced by alternative splicing of a 46 bp exon which encodes 11 COOH-terminal aa followed by an in-frame stop codon. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 650 kb combined. Mutations in DSC2 are associated with arrhythmogenic right ventricular dysplasia-11. DSC2 is Involved in the interaction of plaque proteins and intermediate filaments mediating cell-cell adhesion. DSC2 may contribute to epidermal cell positioning by mediating differential adhesiveness between cells that express different isoforms.

Ссылки
  • Nuber UA, et al. (1995) The widespread human desmocollin Dsc2 and tissue-specific patterns of synthesis of various desmocollin subtypes. Eur J Cell Biol. 66 (1): 69-74.
  • Marsden MD, et al. (1997) Cloning and transcriptional analysis of the promoter of the human type 2 desmocollin gene (DSC2). Gene. 186 (2): 237-47.
  • Greenwood MD, et al. (1997) Exon-intron organization of the human type 2 desmocollin gene (DSC2): desmocollin gene structure is closer to "classical" cadherins than to desmogleins. Genomics. 44 (3): 330-5.
  • Size / Price
    Каталог: HG10809-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».