Быстрый заказ

Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DYRK4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003845.1
Размер кДНК:1563bp
Описание кДНК:Full length Clone DNA of Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 with N terminal His tag.
Синоним гена:DYRK4
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10760-ACGRBS16760
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10760-ACRRBS16760
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10760-ANGRBS16760
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10760-ANRRBS16760
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10760-CFRBS14710
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10760-CHRBS14710
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10760-CMRBS14710
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10760-CYRBS14710
Человек DYRK4 Джин клон кДНК в вектор клонированияHG10760-GRBS5130
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10760-NFRBS14710
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10760-NHRBS14710
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10760-NMRBS14710
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10760-NYRBS14710
Человек DYRK4 Джин ORF экспрессии кДНК клона плазмидыHG10760-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10760-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».