After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DTX3L Информация о продукте «Клон cDNA»
Размер кДНК:2223bp
Описание кДНК:Full length Clone DNA of Homo sapiens deltex 3-like (Drosophila) with N terminal HA tag.
Синоним гена:BBAP
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15202-ACGRBS16760
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15202-ACRRBS16760
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15202-ANGRBS16760
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15202-ANRRBS16760
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15202-CFRBS14710
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15202-CHRBS14710
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15202-CMRBS14710
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15202-CYRBS14710
Человек DTX3L Джин клон кДНК в вектор клонированияHG15202-GRBS5130
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15202-NFRBS14710
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15202-NHRBS14710
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15202-NMRBS14710
Человек DTX3L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15202-NYRBS14710
Человек DTX3L Джин ORF экспрессии кДНК клона плазмидыHG15202-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15202-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.