Быстрый заказ

Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DSG2 Информация о продукте «Клон cDNA»
Размер кДНК:3357bp
Описание кДНК:Full length Clone DNA of Homo sapiens desmoglein 2 with N terminal His tag.
Синоним гена:ARVC10, ARVD10, CDHF5, CMD1BB, HDGC, MGC117034, MGC117036, MGC117037, DSG2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13684-ACGRBS22240
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13684-ACRRBS22240
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13684-CFRBS20190
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13684-CHRBS20190
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13684-CMRBS20190
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13684-CYRBS20190
Человек DSG2/desmoglein 2 Джин клон кДНК в вектор клонированияHG13684-GRBS5130
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13684-NFRBS20190
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13684-NHRBS20190
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13684-NMRBS20190
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13684-NYRBS20190
Человек DSG2/desmoglein 2 Джин ORF экспрессии кДНК клона плазмидыHG13684-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13684-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.