Быстрый заказ

Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек DRD2 Информация о продукте «Клон cDNA»
Размер кДНК:1374 bp
Описание кДНК:Full length Clone DNA of Homo sapiens dopamine receptor D2 with N terminal HA tag.
Синоним гена:D2DR,D2R
Участок рестрикции:KpnI + XbaI(6kb+1.37kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with DRD2 qPCR primers for gene expression analysis, HP101638 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12111-ACGRBS15400
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12111-ACRRBS15400
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12111-CFRBS13340
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12111-CHRBS13340
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12111-CMRBS13340
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12111-CYRBS13340
Человек Dopamine D2 Receptor/DRD2 Джин клон кДНК в вектор клонированияHG12111-MRBS5130
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12111-NFRBS13340
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12111-NHRBS13340
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12111-NMRBS13340
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12111-NYRBS13340
Человек Dopamine D2 Receptor/DRD2 Джин ORF экспрессии кДНК клона плазмидыHG12111-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12111-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
  • Cynomolgus LOC101926731 Gene Plasmid Map 5628
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.