Быстрый заказ

Text Size:AAA

Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DPYS Информация о продукте «Клон cDNA»
Размер кДНК:1561bp
Описание кДНК:Full length Clone DNA of Homo sapiens dihydropyrimidinase with N terminal Myc tag.
Синоним гена:DHP, DHPase
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14884-ACGRBS16760
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14884-ACRRBS16760
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14884-ANGRBS16760
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14884-ANRRBS16760
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14884-CFRBS14710
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14884-CHRBS14710
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14884-CMRBS14710
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14884-CYRBS14710
Человек DPYS / Dihydropyrimidinase Джин клон кДНК в вектор клонированияHG14884-GRBS5130
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14884-NFRBS14710
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14884-NHRBS14710
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14884-NMRBS14710
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14884-NYRBS14710
Человек DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмидыHG14884-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. It can catalyzes the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. DPYS is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.

  • Thomas HR. et al., 2008, Genomics. 18 (1): 25-35.
  • Thomas HR. et al., 2008, Pharmacogenet Genomics. 17 (11): 973-87.
  • Van Kuilenburg AB. et al., 2007, Mol Genet Metab. 91 (2): 157-64.
  • Size / Price
    Каталог: HG14884-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.