Быстрый заказ

Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DPP7 Информация о продукте «Клон cDNA»
Размер кДНК:1479bp
Описание кДНК:Full length Clone DNA of Homo sapiens dipeptidyl-peptidase 7 with N terminal His tag.
Синоним гена:QPP, DPP2, DPPII, DPP7
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10748-ACGRBS15400
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10748-ACRRBS15400
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10748-CFRBS13340
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10748-CHRBS13340
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10748-CMRBS13340
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10748-CYRBS13340
Человек DPP7 / DPPII / DPP2 Джин клон кДНК в вектор клонированияHG10748-MRBS5130
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10748-NFRBS13340
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10748-NHRBS13340
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10748-NMRBS13340
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10748-NYRBS13340
Человек DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмидыHG10748-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

DPP7 (dipeptidylpeptidase 7), also known as DPPII and DPP2, is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. Dipeptidyl peptidases (DPPs) have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. DPPs mediate regulatory activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. DPPs can bind specific voltage-gated potassium channels and alter their expression and biophysical properties and may also influence T cells. DPP proteins include DPRP1, DPRP2, DPP3, DPP7, DPP10, DPPX and CD26. It localizes to lysosomes. DPP7 localizes to lysosomes and exists as a homodimer via its leucine zipper motif and is involved in the degradation of oligopeptides. In response to calcium release, it can be secreted in its active form. It is essential for lymphocyte survival, as the inhibition of DPP7 results in quiescent cell apoptosis.

  • Chiravuri M, et al. (1999) A novel apoptotic pathway in quiescent lymphocytes identified by inhibition of a post-proline cleaving aminodipeptidase: a candidate target protease, quiescent cell proline dipeptidase. J Immunol. 163(6):3092-9.
  • Fukasawa KM, et al. (2001) Cloning and functional expression of rat kidney dipeptidyl peptidase II. Biochem J. 353(Pt 2):283-90.
  • Fornas E, et al. (1992) Effect of cholesterol and its autooxidation derivatives on endocytosis and dipeptidyl peptidases of aortic endothelial cells. Histol Histopathol. 7(2):163-8.
  • Size / Price
    Каталог: HG10748-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.