Быстрый заказ

Text Size:AAA

Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DPEP1 Информация о продукте «Клон cDNA»
Размер кДНК:1236bp
Описание кДНК:Full length Clone DNA of Homo sapiens dipeptidase 1 (renal) with C terminal Myc tag.
Синоним гена:MDP, RDP, MBD1, DPEP1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13543-ACGRBS15400
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13543-ACRRBS15400
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13543-CFRBS13340
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13543-CHRBS13340
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13543-CMRBS13340
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13543-CYRBS13340
Человек dehydropeptidase-I / DPEP1 Джин клон кДНК в вектор клонированияHG13543-GRBS5130
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13543-NFRBS13340
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13543-NHRBS13340
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13543-NMRBS13340
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13543-NYRBS13340
Человек dehydropeptidase-I / DPEP1 Джин ORF экспрессии кДНК клона плазмидыHG13543-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Dehydropeptidase-I, also known as DPEP1, is a kidney membrane enzyme. Its expression in normal colonic mucosa is very low, but it is highly expressed in colorectal adenoma and cancer specimens and is negatively correlated with parameters of pathological aggressiveness and poor prognosis. The overexpression of DPEP1 suppressed tumor cells invasiveness and increased sensitivity to chemotherapeutic agent Gemcitabine. Growth factor EGF treatment decreased DPEP1 expression. Dehydropeptidase-I may be a candidate target in PDAC for designing improved treatments. It uses zinc as a cofactor and acts as a disulfide-linked homodimer.

  • Toiyama Y. et al., 2011, J Gastroenterol. 46 (2): 153-63.
  • Zhang G. et al., 2012, PLoS One. 7 (2): e31507.
  • Okamoto T. et al., 2011, Mod Pathol. 24 (2): 267-76.
  • Size / Price
    Каталог: HG13543-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.