After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DPCD Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015448.1
Размер кДНК:612bp
Описание кДНК:Full length Clone DNA of Homo sapiens deleted in primary ciliary dyskinesia homolog (mouse) with C terminal His tag.
Синоним гена:RP11-529I10.4
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14594-ACGRBS15400
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14594-ACRRBS15400
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14594-ANGRBS15400
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14594-ANRRBS15400
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14594-CFRBS13340
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14594-CHRBS13340
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14594-CMRBS13340
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14594-CYRBS13340
Человек DPCD Джин клон кДНК в вектор клонированияHG14594-GRBS5130
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14594-NFRBS13340
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14594-NHRBS13340
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14594-NMRBS13340
Человек DPCD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14594-NYRBS13340
Человек DPCD Джин ORF экспрессии кДНК клона плазмидыHG14594-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14594-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».