Быстрый заказ

Text Size:AAA

Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DNAJB11 Информация о продукте «Клон cDNA»
Размер кДНК:1077bp
Описание кДНК:Full length Clone DNA of Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 11 with N terminal Flag tag.
Синоним гена:DJ9, EDJ, Dj-9, ERj3, ABBP2, ERdj3, ERj3p, hDj-9, ABBP-2, UNQ537, PRO1080, DNAJB11
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13374-ACGRBS15396
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13374-ACRRBS15396
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13374-CFRBS13343
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13374-CHRBS13340
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13374-CMRBS13343
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13374-CYRBS13340
Человек DNAJB11/ERdj3 Джин клон кДНК в вектор клонированияHG13374-GRBS5132
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13374-NFRBS13340
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13374-NHRBS13343
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13374-NMRBS13343
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13374-NYRBS13340
Человек DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмидыHG13374-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13374-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.