After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DLL4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_019074.2
Размер кДНК:2058bp
Описание кДНК:Full length Clone DNA of Homo sapiens delta-like 4 (Drosophila) with N terminal Myc tag.
Синоним гена:DLL4, hdelta2, MGC126344
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-DLL4
Участок рестрикции:KpnI(two restriction sites) + XbaI (6kb + 1.72kb + 0.35kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human DLL4 Gene Plasmid Map
Human DLL4 ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10171-ACGRBS16760
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10171-ACRRBS16760
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10171-CFRBS14710
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10171-CHRBS14710
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10171-CMRBS14710
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10171-CYRBS14710
Человек DLL4/Delta-like 4 Джин клон кДНК в вектор клонированияHG10171-MRBS5130
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмидыHG10171-M-NRBS14710
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10171-NFRBS14710
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10171-NHRBS14710
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10171-NMRBS14710
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10171-NYRBS14710
Человек DLL4/Delta-like 4 Джин ORF экспрессии кДНК клона плазмидыHG10171-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of five known Notch ligands in mammals and interacts predominantly with Notch 1, which has a key role in vascular development. Recent studies yield substantial insights into the role of DLL4 in angiogenesis. DLL4 is induced by vascular endothelial growth factor (VEGF) and acts downstream of VEGF as a 'brake' on VEGF-induced vessel growth, forming an autoregulatory negative feedback loop inactivating VEGF. DLL4 is downstream of VEGF signaling and its activation triggers a negative feedback that restrains the effects of VEGF. Attenuation of DLL4/Notch signaling results in chaotic vascular network with excessive branching and sprouting. DLL4 is widely distributed in tissues other than vessels including many malignancies. Furthermore, the molecule is internalized on binding its receptor and often transported to the nucleus. In pathological conditions, such as cancer, DLL4 is up-regulated strongly in the tumour vasculature. Blockade of DLL4-mediated Notch signaling strikingly increases nonproductive angiogenesis, but significantly inhibits tumor growth in preclinical mouse models. In preclinical studies, blocking of DLL4/Notch signaling is associated with a paradoxical increase in tumor vessel density, yet causes marked growth inhibition due to functionally defective vasculature. Thus, DLL4 blockade holds promise as an additional strategy for angiogenesis-based cancer therapy.

Ссылки
  • Yan M, et al. (2007) Delta-like 4/Notch signaling and its therapeutic implications. Clin Cancer Res. 13(24): 7243-6.
  • Sainson RC, et al. (2007) Anti-Dll4 therapy: can we block tumour growth by increasing angiogenesis? Trends Mol Med. 13(9): 389-95.
  • Martinez JC, et al. (2009) Nuclear and membrane expression of the angiogenesis regulator delta-like ligand 4 (DLL4) in normal and malignant human tissues. Histopathology. 54(5): 598-606.
  • Li JL, et al. (2010) Targeting DLL4 in tumors shows preclinical activity but potentially significant toxicity. Future Oncol. 6(7): 1099-103.
  • Size / Price
    Каталог: HG10171-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human DLL4 ORF mammalian expression plasmid, N-Myc tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».