After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DLL1 Информация о продукте «Клон cDNA»
Размер кДНК:2172bp
Описание кДНК:Full length Clone DNA of Homo sapiens delta-like 1 (Drosophila) with C terminal Flag tag.
Синоним гена:DL1; Delta; DELTA1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human DLL1 Gene Plasmid Map
Human DLL1 ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11635-ACGRBS16760
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11635-ACRRBS16760
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11635-CFRBS14710
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11635-CHRBS14710
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11635-CMRBS14710
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11635-CYRBS14710
Человек DLL1 / Delta-like 1 Джин клон кДНК в вектор клонированияHG11635-MRBS5130
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмидыHG11635-M-NRBS14710
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11635-NFRBS14710
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11635-NHRBS14710
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11635-NMRBS14710
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11635-NYRBS14710
Человек DLL1 / Delta-like 1 Джин клон кДНК в вектор клонированияHG11635-URBS5130
Человек DLL1 / Delta-like 1 Джин ORF экспрессии кДНК клона плазмидыHG11635-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Delta-like protein 1(DLL1), also known as Delta1, a single-pass type I membrane protein which contains one DSL domain and eight EGF-like domains,  acts as a ligand for Notch receptors, and positively regulates T-cell development. DLL1 is proteolytically processed in a similar manner to the Notch receptor, and it has been speculated to participate in bidirectional signaling. The proteolytic processing of DLL1 helps achieve an asymmetry in Notch signaling in initially equivalent myogenic cells and helps sustain the balance between differentiation and self-renewal. Interactions between DLL1 and Notch in trans activate the Notch pathway, whereas DLL1 binding to Notch in cis inhibits Notch signaling. DLL1 undergoes proteolytic processing in its extracellular domain by ADAM10. It had been demonstrated that DLL1 represents a substrate for several other members of the ADAM family. In co-transfected cells, DLL1 is constitutively cleaved by ADAM12, and the N-terminal fragment of DLL1 is released to medium. ADAM12-mediated cleavage of DLL1 is cell density-dependent, takes place in cis orientation, and does not require the presence of the cytoplasmic domain of ADAM12. Full-length DLL1, but not its N- or C-terminal proteolytic fragment, co-immunoprecipitates with ADAM12. By using a Notch reporter construct, we show that DLL1 processing by ADAM12 increases Notch signaling in a cell-autonomous manner. Furthermore, ADAM9 and ADAM17 have the ability to process DLL1. In contrast, ADAM15 does not cleave DLL1, although the two proteins still co-immunoprecipitate with each other. During fetal development, DLL1 is an essential Notch ligand in the vascular endothelium of large arteries to activate Notch1 and maintain arterial identity. DLL1-Notch signaling was required for VEGF receptor expression in fetal arteries.

  • Dyczynska E, et al. (2007) Proteolytic processing of delta-like 1 by ADAM proteases. J Biol Chem. 282(1): 436-44.
  • Sun D, et al. (2008) The role of Delta-like 1 shedding in muscle cell self-renewal and differentiation. J Cell Sci. 121(Pt 22): 3815-23.
  • Srensen I, et al. (2009) DLL1-mediated Notch activation regulates endothelial identity in mouse fetal arteries. Blood. 113(22): 5680-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.