Быстрый заказ

Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек DIRAS3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC005362
    Размер кДНК:690bp
    Описание кДНК:Full length Clone DNA of Homo sapiens DIRAS family, GTP-binding RAS-like 3.
    Синоним гена:ARHI, NOEY2, DIRAS3
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DIRAS3 qPCR primers for gene expression analysis, HP102889 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14239-ACGRBS15400
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14239-ACRRBS15400
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14239-ANGRBS15400
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14239-ANRRBS15400
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14239-CFRBS13340
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14239-CHRBS13340
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14239-CMRBS13340
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14239-CYRBS13340
    Человек ARHI / DIRAS3 Джин клон кДНК в вектор клонированияHG14239-GRBS5130
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14239-NFRBS13340
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14239-NHRBS13340
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14239-NMRBS13340
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14239-NYRBS13340
    Человек ARHI / DIRAS3 Джин ORF экспрессии кДНК клона плазмидыHG14239-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    ARHI, also known as DIRAS3, belongs to the small GTPase superfamily, Di-Ras family. ARHI gene is a novel tumor suppressor gene located on chromosome 1p31. Downregulation of ARHI expression has been detected in many types of cancer. ARHI is expressed in normal ovarian and breast epithelial cells but not in ovarian and breast cancers. As a suppressor, ARHI is not only an important factor in the pathogenesis of gastric cancer, but also a potential factor for tumor aggravation. ARHI expression in gastric cancer can be employed to indicate favorable prognosis for the disease.

    Ссылки
  • Pei XH. et al., 2011, Cell Biol Int. 35 (10): 1019-24.
  • Lin D. et al., 2011, J Int Med Res. 39 (5): 1870-5.
  • Wang W. et al., 2012, Oncol Rep. 27 (6): 1953-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».