After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human DHRSX Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC032340
Размер кДНК:993bp
Описание кДНК:Full length Clone DNA of Homo sapiens dehydrogenase/reductase (SDR family) X-linked.
Синоним гена:DHRSY, DHRS5X, DHRS5Y, DHRSXY, CXorf11, SDR46C1, DHRSX
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13284-ACGRBS15400
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13284-ACRRBS15400
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13284-CFRBS13340
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13284-CHRBS13340
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13284-CMRBS13340
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13284-CYRBS13340
Человек DHRSX Джин клон кДНК в вектор клонированияHG13284-GRBS5130
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13284-NFRBS13340
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13284-NHRBS13340
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13284-NMRBS13340
Человек DHRSX Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13284-NYRBS13340
Человек DHRSX Джин ORF экспрессии кДНК клона плазмидыHG13284-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13284-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».