Быстрый заказ

Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек DHRS9 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC058883
    Размер кДНК:960bp
    Описание кДНК:Full length Clone DNA of Homo sapiens dehydrogenase/reductase (SDR family) member 9 DNA.
    Синоним гена:RDHL, RDH15, RDHTBE, SDR9C4, RDH-TBE, RETSDR8, 3ALPHA-HSD
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DHRS9 qPCR primers for gene expression analysis, HP103879 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15253-ACGRBS15400
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15253-ACRRBS15400
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15253-CFRBS13340
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15253-CHRBS13340
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15253-CMRBS13340
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15253-CYRBS13340
    Человек DHRS9/3-alpha-HSD Джин клон кДНК в вектор клонированияHG15253-GRBS5130
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15253-NFRBS13340
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15253-NHRBS13340
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15253-NMRBS13340
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15253-NYRBS13340
    Человек DHRS9/3-alpha-HSD Джин ORF экспрессии кДНК клона плазмидыHG15253-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15253-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».