Быстрый заказ

Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек DHRS7 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC000637
    Размер кДНК:1020bp
    Описание кДНК:Full length Clone DNA of Homo sapiens dehydrogenase/reductase (SDR family) member 7.
    Синоним гена:CGI-86, SDR34C1, retDSR4, retSDR4, DHRS7
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DHRS7 qPCR primers for gene expression analysis, HP101999 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13291-ACGRBS15400
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13291-ACRRBS15400
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13291-CFRBS13340
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13291-CHRBS13340
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13291-CMRBS13340
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13291-CYRBS13340
    Человек DHRS7 Джин клон кДНК в вектор клонированияHG13291-GRBS5130
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13291-NFRBS13340
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13291-NHRBS13340
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13291-NMRBS13340
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13291-NYRBS13340
    Человек DHRS7 Джин ORF экспрессии кДНК клона плазмидыHG13291-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13291-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».