Быстрый заказ

Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек DHRS2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_005794.3
    Размер кДНК:843bp
    Описание кДНК:Full length Clone DNA of Homo sapiens dehydrogenase/reductase (SDR family) member 2.
    Синоним гена:HEP27, SDR25C1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DHRS2 qPCR primers for gene expression analysis, HP104924 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16155-ACGRBS15400
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16155-ACRRBS15400
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16155-ANGRBS15400
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16155-ANRRBS15400
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16155-CFRBS13340
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16155-CHRBS13340
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16155-CMRBS13340
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16155-CYRBS13340
    Человек DHRS2 Джин клон кДНК в вектор клонированияHG16155-GRBS5130
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16155-NFRBS13340
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16155-NHRBS13340
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16155-NMRBS13340
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16155-NYRBS13340
    Человек DHRS2 Джин ORF экспрессии кДНК клона плазмидыHG16155-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».