After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human DHRS2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005794.3
Размер кДНК:843bp
Описание кДНК:Full length Clone DNA of Homo sapiens dehydrogenase/reductase (SDR family) member 2.
Синоним гена:HEP27, SDR25C1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16155-ACGRBS15400
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16155-ACRRBS15400
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16155-ANGRBS15400
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16155-ANRRBS15400
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16155-CFRBS13340
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16155-CHRBS13340
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16155-CMRBS13340
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16155-CYRBS13340
Человек DHRS2 Джин клон кДНК в вектор клонированияHG16155-GRBS5130
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16155-NFRBS13340
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16155-NHRBS13340
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16155-NMRBS13340
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16155-NYRBS13340
Человек DHRS2 Джин ORF экспрессии кДНК клона плазмидыHG16155-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16155-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».