Deoxyguanosine kinase cDNA ORF Clone, Human, N-HA tag

Cat: HG15064-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Deoxyguanosine kinase Reagents

CRO Services

Product recommended


All Deoxyguanosine kinase Reagents

Deoxyguanosine kinase cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Human deoxyguanosine kinase with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Deoxyguanosine kinase cDNA ORF Clone, Human, N-HA tag Alternative Names

dGK cDNA ORF Clone, Human;MTDPS3 cDNA ORF Clone, Human

Deoxyguanosine kinase Background Information

Full Name
deoxyguanosine kinase

Deoxyguanosine kinase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Deoxyguanosine kinase cDNA ORF Clone in Cloning Vector, Rat RG86598-U
Deoxyguanosine kinase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86598-ACGLN

Deoxyguanosine kinase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Deoxyguanosine kinase cDNA ORF Clone in Cloning Vector, Mouse MG53505-G
Deoxyguanosine kinase cDNA ORF Clone, Mouse, untagged MG53505-UT
Deoxyguanosine kinase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53505-ACGLN
Deoxyguanosine kinase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53505-ACG
Deoxyguanosine kinase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53505-ANG
Deoxyguanosine kinase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53505-ACR
Deoxyguanosine kinase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53505-ANR
Deoxyguanosine kinase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53505-CF
Deoxyguanosine kinase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53505-NF
Deoxyguanosine kinase cDNA ORF Clone, Mouse, C-His tag MG53505-CH
Deoxyguanosine kinase cDNA ORF Clone, Mouse, N-His tag MG53505-NH
Deoxyguanosine kinase cDNA ORF Clone, Mouse, C-HA tag MG53505-CY
Deoxyguanosine kinase cDNA ORF Clone, Mouse, N-HA tag MG53505-NY
Deoxyguanosine kinase cDNA ORF Clone, Mouse, C-Myc tag MG53505-CM
Deoxyguanosine kinase cDNA ORF Clone, Mouse, N-Myc tag MG53505-NM

Deoxyguanosine kinase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Deoxyguanosine kinase cDNA ORF Clone in Cloning Vector, Human HG15064-G
Deoxyguanosine kinase cDNA ORF Clone, Human, untagged HG15064-UT
Deoxyguanosine kinase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15064-ACGLN
Deoxyguanosine kinase cDNA ORF Clone, Human, C-GFPSpark® tag HG15064-ACG
Deoxyguanosine kinase cDNA ORF Clone, Human, N-GFPSpark® tag HG15064-ANG
Deoxyguanosine kinase cDNA ORF Clone, Human, C-OFPSpark® tag HG15064-ACR
Deoxyguanosine kinase cDNA ORF Clone, Human, N-OFPSpark® tag HG15064-ANR
Deoxyguanosine kinase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15064-CF
Deoxyguanosine kinase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15064-NF
Deoxyguanosine kinase cDNA ORF Clone, Human, C-His tag HG15064-CH
Deoxyguanosine kinase cDNA ORF Clone, Human, N-His tag HG15064-NH
Deoxyguanosine kinase cDNA ORF Clone, Human, C-HA tag HG15064-CY
Deoxyguanosine kinase cDNA ORF Clone, Human, C-Myc tag HG15064-CM
Deoxyguanosine kinase cDNA ORF Clone, Human, N-Myc tag HG15064-NM
Deoxyguanosine kinase qPCR Primer Pairs, Human HP103692
info info
添加购物车成功! 添加购物车失败!