DDRGK1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

DDRGK1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
945 bp
Description
Full length Clone DNA of Human DDRGK domain containing 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DDRGK1 cDNA ORF Clone, Human, untagged: Alternative Names

C20orf116 cDNA ORF Clone, Human; dJ1187M17.3 cDNA ORF Clone, Human; UFBP1 cDNA ORF Clone, Human

DDRGK1 Background Information

DDRGK1 is a member of the DDRGK domain-containing protein family, DDRGK1 is an ER membrane protein and a critical component of the ubiquitin-fold modifier 1 (Ufm1) system and the depletion of DDRGK1 inhibits cell proliferation and invasion. DDRGK1 as an important regulator of the NF-kappaB pathway, Microarray analysis indicated that the expression of NF-kappaB target genes showed the most significant decrease after depleting of DDRGK1, suggesting that DDRGK1 may play an important role in the NF-kappaB signaling pathway.
Full Name
DDRGK domain containing 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait