Быстрый заказ

Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human DDRGK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC007957
Размер кДНК:945bp
Описание кДНК:Full length Clone DNA of Homo sapiens DDRGK domain containing 1.
Синоним гена:UFBP1, C20orf116, dJ1187M17.3, DDRGK1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13287-ACGRBS15400
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13287-ACRRBS15400
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13287-CFRBS13340
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13287-CHRBS13340
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13287-CMRBS13340
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13287-CYRBS13340
Человек DDRGK1 Джин клон кДНК в вектор клонированияHG13287-GRBS5130
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13287-NFRBS13340
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13287-NHRBS13340
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13287-NMRBS13340
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13287-NYRBS13340
Человек DDRGK1 Джин ORF экспрессии кДНК клона плазмидыHG13287-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13287-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».