Быстрый заказ

Text Size:AAA

Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DDC Информация о продукте «Клон cDNA»
Размер кДНК:1443bp
Описание кДНК:Full length Clone DNA of Homo sapiens dopa decarboxylase (aromatic L-amino acid decarboxylase) with N terminal Flag tag.
Синоним гена:AADC
Участок рестрикции:HindIII + XbaI (6kb + 1.48kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human DDC Gene Plasmid Map
Human DDC natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10560-ACGRBS15400
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10560-ACRRBS15400
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10560-ANGRBS15400
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10560-ANRRBS15400
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10560-CFRBS13340
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10560-CHRBS13340
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10560-CMRBS13340
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10560-CYRBS13340
Человек DOPA Decarboxylase/DDC Джин клон кДНК в вектор клонированияHG10560-MRBS5130
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмидыHG10560-M-NRBS13340
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10560-NFRBS13340
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10560-NHRBS13340
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10560-NMRBS13340
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10560-NYRBS13340
Человек DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмидыHG10560-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    Каталог: HG10560-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human DDC natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.