DDB2 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

DDB2 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1284 bp
Description
Full length Clone DNA of Human damage-specific DNA binding protein 2, 48kDa with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DDB2 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

DDBB cDNA ORF Clone, Human; UV-DDB2 cDNA ORF Clone, Human

DDB2 Background Information

The DNA-Damage Binding protein 2 (DDB2) complex is a DRC that initiates nucleotide excision repair (NER) of DNA damage caused by ultraviolet light (UV). DNA damage-binding protein 2 (DDB2) is a DNA repair factor mainly involved in nucleotide excision repair. Overexpressing DDB2 in human ovarian cancer cells suppressed its capability to recapitulate tumors in athymic nude mice. Mechanistic investigation demonstrated that DDB2 is able to reduce the cancer stem cell (CSC) population characterized with high aldehyde dehydrogenase activity in ovarian cancer cells, probably through disrupting the self-renewal capacity of CSCs. The expression of DNA damage-binding protein 2 (DDB2) has been linked to the prognosis of ovarian cancer and its underlying transcription regulatory function was proposed to contribute to the favorable treatment outcome. DDB2 is the product of the xeroderma pigmentosum group E gene which is involved in the initiation of nucleotide excision repair via an ubiquitin ligase complex together with DDB1 and CUL4A (cullin 4A). DDB2 is a nuclear protein, participates in both nucleotide excision repair and mRNA transcription. The transcriptional regulatory function of DDB2 is significant in colon cancer, as it regulates metastasis.
Full Name
damage-specific DNA binding protein 2, 48kDa
Add to Cart Successfully Add to Cart Failed