Быстрый заказ

Text Size:AAA

Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DCXR Информация о продукте «Клон cDNA»
Размер кДНК:735bp
Описание кДНК:Full length Clone DNA of Homo sapiens dicarbonyl/L-xylulose reductase with N terminal Flag tag.
Синоним гена:XR, DCR, HCR2, P34H, HCRII, KIDCR, SDR20C1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14562-ACGRBS15396
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14562-ACRRBS15396
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14562-CFRBS13343
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14562-CHRBS13343
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14562-CMRBS13343
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14562-CYRBS13343
Человек DCXR / HCR2 Джин клон кДНК в вектор клонированияHG14562-GRBS5132
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14562-NFRBS13343
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14562-NHRBS13343
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14562-NMRBS13343
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14562-NYRBS13343
Человек DCXR / HCR2 Джин ORF экспрессии кДНК клона плазмидыHG14562-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

DCXR, also known as HCR2, belongs to the short-chain dehydrogenases/reductases (SDR) family. It is highly expressed in kidney, liver and epididymis. In the epididymis, DCXR is mainly expressed in the proximal and distal sections of the corpus region. HCR2 is weakly or not expressed in brain, lung, heart, spleen and testis. DCXR catalyzes the NADPH-dependent reduction of several pentoses, tetroses, trioses, alpha-dicarbonyl compounds and L-xylulose. DCXR participates in the uronate cycle of glucose metabolism. It may play a role in the water absorption and cellular osmoregulation in the proximal renal tubules by producing xylitol, an osmolyte, thereby preventing osmolytic stress from occurring in the renal tubules.

  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Pierce SB, et al. (2011) Garrod's fourth inborn error of metabolism solved by the identification of mutations causing pentosuria. Proc Natl Acad Sci. 108(45):18313-7.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.
  • Size / Price
    Каталог: HG14562-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.