After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human DCUN1D5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC004169
Размер кДНК:714bp
Описание кДНК:Full length Clone DNA of Homo sapiens DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae).
Синоним гена:FLJ32431, FLJ37425, MGC2714, DCUN1D5
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14263-ACGRBS15400
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14263-ACRRBS15400
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14263-ANGRBS15400
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14263-ANRRBS15400
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14263-CFRBS13340
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14263-CHRBS13340
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14263-CMRBS13340
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14263-CYRBS13340
Человек DCUN1D5 Джин клон кДНК в вектор клонированияHG14263-GRBS5130
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14263-NFRBS13340
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14263-NHRBS13340
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14263-NMRBS13340
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14263-NYRBS13340
Человек DCUN1D5 Джин ORF экспрессии кДНК клона плазмидыHG14263-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14263-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».