Быстрый заказ

Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DCTPP1 Информация о продукте «Клон cDNA»
Размер кДНК:513bp
Описание кДНК:Full length Clone DNA of Homo sapiens dCTP pyrophosphatase 1 with N terminal Flag tag.
Синоним гена:CDA03, RS21C6, XTP3TPA
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14577-ACGRBS15400
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14577-ACRRBS15400
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14577-ANGRBS15400
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14577-ANRRBS15400
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14577-CFRBS13340
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14577-CHRBS13340
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14577-CMRBS13340
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14577-CYRBS13340
Человек XTP3TPA / DCTPP1 Джин клон кДНК в вектор клонированияHG14577-GRBS5130
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14577-NFRBS13340
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14577-NHRBS13340
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14577-NMRBS13340
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14577-NYRBS13340
Человек XTP3TPA / DCTPP1 Джин ORF экспрессии кДНК клона плазмидыHG14577-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

DCTPP1 hydrolyzes deoxynucleoside triphosphates (dNTPs) to the corresponding nucleoside monophosphates. It has a strong preference for modified dCTP. DCTPP1’s activity is highest with 5-iodo-dCTP, followed by 5-bromo-dCTP, unmodified dCTP, 5-methyl-dCTP and 5-chloro-dCTP. DCTPP1 also hydrolyzes 2-chloro-dATP and 2-hydroxy-dATP with lower efficiency, and has even lower activity with unmodified dATP, dTTP and dUTP (in vitro). DCTPP1 does not hydrolyze ATP, UTP, ITP, GTP, dADP, dCDP or dGTP. It may protect DNA or RNA against the incorporation of non-canonical nucleotide triphosphates. DCTPP1 may also protect cells against inappropriate methylation of CpG islands by DNA methyltransferases.

  • Stelzl U. et al., 2005, Cell. 122 (6): 957-68.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Moroz OV. et al., 2005, J Mol Biol. 347 (2): 243-55.
  • Size / Price
    Каталог: HG14577-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.