After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human DBI Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC062996
Размер кДНК:315bp
Описание кДНК:Full length Clone DNA of Homo sapiens diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) DNA.
Синоним гена:EP, ACBP, ACBD1, CCK-RP
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15211-ACGRBS15400
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15211-ACRRBS15400
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15211-ANGRBS15400
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15211-ANRRBS15400
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15211-CFRBS13340
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15211-CHRBS13340
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15211-CMRBS13340
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15211-CYRBS13340
Человек DBI / ACBD1 Джин клон кДНК в вектор клонированияHG15211-GRBS5130
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15211-NFRBS13340
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15211-NHRBS13340
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15211-NMRBS13340
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15211-NYRBS13340
Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмидыHG15211-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15211-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».