Быстрый заказ

Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек DBI Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC062996
    Размер кДНК:315bp
    Описание кДНК:Full length Clone DNA of Homo sapiens diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) DNA.
    Синоним гена:EP, ACBP, ACBD1, CCK-RP
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DBI qPCR primers for gene expression analysis, HP103837 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15211-ACGRBS15400
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15211-ACRRBS15400
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15211-ANGRBS15400
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15211-ANRRBS15400
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15211-CFRBS13340
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15211-CHRBS13340
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15211-CMRBS13340
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15211-CYRBS13340
    Человек DBI / ACBD1 Джин клон кДНК в вектор клонированияHG15211-GRBS5130
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15211-NFRBS13340
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15211-NHRBS13340
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15211-NMRBS13340
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15211-NYRBS13340
    Человек DBI / ACBD1 Джин ORF экспрессии кДНК клона плазмидыHG15211-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15211-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».