After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DBH Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC017174
Размер кДНК:1812bp
Описание кДНК:Full length Clone DNA of Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxyge) with N terminal HA tag.
Синоним гена:DBM, DBH
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13440-ACGRBS16764
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13440-ACRRBS16764
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13440-ANGRBS16764
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13440-ANRRBS16764
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13440-CFRBS14711
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13440-CHRBS14711
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13440-CMRBS14711
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13440-CYRBS14711
Человек DBH / Dopamine beta-Hydroxylase Джин клон кДНК в вектор клонированияHG13440-GRBS5132
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13440-NFRBS14711
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13440-NHRBS14711
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13440-NMRBS14711
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13440-NYRBS14711
Человек DBH / Dopamine beta-Hydroxylase Джин ORF экспрессии кДНК клона плазмидыHG13440-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

DBH is a 290 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the central and peripheral nervous systems, and is also expressed in chromaffin cells of the adrenal medulla. DBH contains our identical subunits, and its activity requires ascorbate as a cofactor. It functions in in the synthesis of small-molecule neurotransmitters that is membrane-bound, making norepinephrine the only transmitter synthesized inside vesicles. DBH has been shown to be associated with decision making and addictive behaviors such as alcohol and smoking, attention deficit hyperactivity disorder, and also with neurological diseases such as Schizophrenia and Alzheimer's.

Ссылки
  • Rush RA. et al., 1980, Crit Rev Clin Lab Sci. 12 (3): 241-77.
  • Goldstein M. et al., 1964, Life Sci. 3 (7): 763-7.
  • S Friedman. et al., 1966, The Journal of Biological Chemistry. 241 (10): 2256-9.
  • Size / Price
    Каталог: HG13440-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».