Быстрый заказ

Text Size:AAA

Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DAPK3 Информация о продукте «Клон cDNA»
Размер кДНК:1365bp
Описание кДНК:Full length Clone DNA of Homo sapiens death-associated protein kinase 3 with N terminal His tag.
Синоним гена:ZIP, ZIPK, FLJ36473, DAPK3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10757-ACGRBS15400
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10757-ACRRBS15400
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10757-ANGRBS15400
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10757-ANRRBS15400
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10757-CFRBS13340
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10757-CHRBS13340
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10757-CMRBS13340
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10757-CYRBS13340
Человек DAPK3/ZIPK Джин клон кДНК в вектор клонированияHG10757-MRBS5130
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10757-M-FRBS13340
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10757-NFRBS13340
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10757-NHRBS13340
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10757-NMRBS13340
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10757-NYRBS13340
Человек DAPK3/ZIPK Джин ORF экспрессии кДНК клона плазмидыHG10757-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Death-associated protein kinase 3, also known as DAP kinase 3, ZIP-kinase, DAPK3 and ZIPK, is a nucleus and cytoplasm protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and DAP kinase subfamily. DAPK3 / ZIPK contains one protein kinase domain. It is a serine/threonine kinase which acts as a positive regulator of apoptosis. It phosphorylates histone H3 on 'Thr-11' at centromeres during mitosis. DAPK3 / ZIPK is a homodimer or forms heterodimers with ATF4. Both interactions require an intact leucine zipper domain and oligomerization is required for full enzymatic activity. It also binds to DAXX and PAWR, possibly in a ternary complex which plays a role in caspase activation. DAPK3 / ZIPK regulates myosin light chain phosphatase through phosphorylation of MYPT1 thereby regulating the assembly of the actin cytoskeleton, cell migration, invasiveness of tumor cells, smooth muscle contraction and neurite outgrowth. It is involved in the formation of promyelocytic leukemia protein nuclear body (PML-NB), one of many subnuclear domains in the eukaryotic cell nucleus, and which is involved in oncogenesis and viral infection.

  • Kawai T., et al., 1998, Mol. Cell. Biol. 18:1642-1651.
  • Murata-Hori M., et al., 1999, FEBS Lett. 451:81-84.
  • Kawai T., et al., 2003, Mol. Cell. Biol. 23:6174-6186.
  • Greenman C., et al., 2007, Nature 446:153-158.
  • Ohbayashi N., et al., 2008, Biochem. Biophys. Res. Commun. 372: 708 -712.
  • Size / Price
    Каталог: HG10757-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.