CST6 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10438-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CST6 Reagents

CRO Services

Product recommended


All CST6 Reagents

CST6 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
450 bp
Description
Full length Clone DNA of Human cystatin E/M with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CST6 Background Information

Cystatin E/M, also referred to as CST6, is a member of type 2 cysteine proteinase inhibitors of the cystatin superfamily, and inhibits papain and cathepsin B. Cystatin E is a low molecular mass secreted protein existing in both a glycosylated (17 kDa) and an unglycosylated (14 kDa) form, with two characteristic intrachain disulfide bridges. Expression of cystatin M/E is found to be restricted to the epidermis, more specifically in the stratum granulosum, sweat glands, sebaceous glands, and the hair follicles. In addition to its function as a cysteine protease inhibitor, cystatin M/E also serves as a target for cross-linking by transglutaminases. Accordingly, cystatin M/E was suggested to be involved in barrier formation and maintenance. Furthermore, studies have revealed that cystatin M/E is frequently epigenetically inactivated during breast carcinogenesis, and thus be regarded as a candidate of tumour suppressor gene.

Full Name
cystatin E/M
References
  • Ritonja A., et al.,(1985), Amino acid sequence of the intracellular cysteine proteinase inhibitor cystatin B from human liver. Biochem. Biophys. Res. Commun. 131:1187-1192.
  • Pennacchio L.A., et al., (1996), Mutations in the gene encoding cystatin B in progressive myoclonus epilepsy (EPM1).Science 271:1731-1734.
  • Ghaemmaghami S., et al.,(2003), Global analysis of protein expression in yeast.Nature 425:737-741.
  • CST6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CST6 cDNA ORF Clone in Cloning Vector, Mouse MG50916-G
    CST6 cDNA ORF Clone, Mouse, untagged MG50916-UT
    CST6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50916-ACGLN
    CST6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50916-ACG
    CST6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50916-ACR
    CST6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50916-CF
    CST6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50916-NF
    CST6 cDNA ORF Clone, Mouse, C-His tag MG50916-CH
    CST6 cDNA ORF Clone, Mouse, N-His tag MG50916-NH
    CST6 cDNA ORF Clone, Mouse, C-HA tag MG50916-CY
    CST6 cDNA ORF Clone, Mouse, N-HA tag MG50916-NY
    CST6 cDNA ORF Clone, Mouse, C-Myc tag MG50916-CM
    CST6 cDNA ORF Clone, Mouse, N-Myc tag MG50916-NM
    CST6 qPCR Primer Pairs, Mouse MP200885

    CST6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CST6 cDNA ORF Clone in Cloning Vector, Human HG10438-M
    CST6 cDNA ORF Clone, Human, untagged HG10438-UT
    CST6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10438-ACG
    CST6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10438-ACGLN
    CST6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10438-ACR
    CST6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10438-CF
    CST6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10438-NF
    CST6 cDNA ORF Clone, Human, C-His tag HG10438-CH
    CST6 cDNA ORF Clone, Human, N-His tag HG10438-NH
    CST6 cDNA ORF Clone, Human, C-HA tag HG10438-CY
    CST6 cDNA ORF Clone, Human, N-HA tag HG10438-NY
    CST6 cDNA ORF Clone, Human, N-Myc tag HG10438-NM
    CST6 qPCR Primer Pairs, Human HP100467
    info info
    添加购物车成功! 添加购物车失败!