Cystatin A cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

Cystatin A cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
297 bp
Description
Full length Clone DNA of Human cystatin A (stefin A) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cystatin A cDNA ORF Clone, Human, C-HA tag: Alternative Names

AREI cDNA ORF Clone, Human; STF1 cDNA ORF Clone, Human; STFA cDNA ORF Clone, Human

Cystatin A Background Information

Cystatin-A, also known as Cystatin-AS, Stefin-A and CSTA, is a cytoplasm protein which belongs to thecystatin family. Cystatin-A / CSTA is a cysteine proteinase inhibitor with a molecular mass of 11 kDa, and is located mainly in the keratohyaline granules of the stratum granulosum and the cornified envelope of the stratum corneum in the epidermis. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).
Full Name
cystatin A
References
  • Machleidt W., et al.,(1983), Protein inhibitors of cysteine proteinases. II. Primary structure of stefin, a cytosolic protein inhibitor of cysteine proteinases from human polymorphonuclear granulocytes. Hoppe-Seyler's Z. Physiol. Chem. 364:1481-1486.
  • Takeda A., et al., (1989), Comparative studies on the primary structure of human cystatin as from epidermis, liver, spleen, and leukocytes.J. Biochem. 105:986-991.
  • Kartasova T., et al.,(1987), Effects of UV, 4-NQO and TPA on gene expression in cultured human epidermal keratinocytes.Nucleic Acids Res. 15:5945-5962.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait