Быстрый заказ

Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CSTA Информация о продукте «Клон cDNA»
Размер кДНК:297bp
Описание кДНК:Full length Clone DNA of Homo sapiens cystatin A (stefin A) with C terminal HA tag.
Синоним гена:STF1, STFA, CSTA
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10479-ACGRBS15400
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10479-ACRRBS15400
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10479-ANGRBS15400
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10479-ANRRBS15400
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10479-CFRBS13340
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10479-CHRBS13340
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10479-CMRBS13340
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10479-CYRBS13340
Человек Cystatin A / CSTA Джин клон кДНК в вектор клонированияHG10479-MRBS5130
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10479-NFRBS13340
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10479-NHRBS13340
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10479-NMRBS13340
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10479-NYRBS13340
Человек Cystatin A / CSTA Джин ORF экспрессии кДНК клона плазмидыHG10479-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cystatin-A, also known as Cystatin-AS, Stefin-A and CSTA, is a cytoplasm protein which belongs to the cystatin family. Cystatin-A / CSTA is a cysteine proteinase inhibitor with a molecular mass of 11 kDa, and is located mainly in the keratohyaline granules of the stratum granulosum and the cornified envelope of the stratum corneum in the epidermis. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).

Size / Price
Каталог: HG10479-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.