Быстрый заказ

Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CHIT1 Информация о продукте «Клон cDNA»
Размер кДНК:1401bp
Описание кДНК:Full length Clone DNA of Homo sapiens chitinase 1 (chitotriosidase) with N terminal Flag tag.
Синоним гена:CHI3, CHIT, FLJ00314, MGC125322
Участок рестрикции:KpnI + XbaI (6kb + 1.43kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CHIT1 Gene Plasmid Map
Human Chitotriosidase / Chitinase 1 / CHIT1 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11223-ACGRBS15400
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11223-ACRRBS15400
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11223-CFRBS13340
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11223-CHRBS13340
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11223-CMRBS13340
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11223-CYRBS13340
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин клон кДНК в вектор клонированияHG11223-MRBS5130
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11223-NFRBS13340
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11223-NHRBS13340
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11223-NMRBS13340
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11223-NYRBS13340
Человек Chitotriosidase/Chitinase 1/CHIT1 Джин ORF экспрессии кДНК клона плазмидыHG11223-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Chitotriosidase, also known as Chitinase-1 and CHIT1, is a member of the glycosyl hydrolase 18 family and Chitinase class II subfamily. It is a member of the mammalian chitinase family, structurally homologous to chitinases from other species, is synthesized and secreted by specifically activated macrophages. Chitotriosidase is a polymer of N-acetylglucosamine. Serum and plasma chitotriosidase activity is usually measured as the first step in diagnosis of Gaucher disease. Monitoring chitotriosidase activity is widely used during treatment of this pathology by enzyme replacement therapy. Its elevated plasma level reflects gradual intralysosomal accumulation in Gaucher cells (lipid-loaded macrophages). Macrophages overloaded by the enzyme accumulated in lysosomal material (lipids) were shown to secrete chitotriosidase; its increased expression was noted in several lysosomal storage diseases and atherosclerosis. In addition to lipid storage disorders, where Chit activity has longer been used as a marker of disease activity and therapeutic response, elevation of plasma Chit may occur in hematological disorders with storage of erythrocyte membrane breakdown products as thalassemia and different systemic infectious diseases sustained by fungi and other pathogens. Recently, increased Chit activity was demonstrated in CNS from patients with different neurological disorders. Chitotriosidase is believed to play a role in mechanisms of immunity and protection against chitin-containing pathogens.

  • Barone R, et al. (2007) Plasma chitotriosidase in health and pathology. Clin Lab. 53(5-6): 321-33.
  • Bargagli E, et al. (2008) Human chitotriosidase: a potential new marker of sarcoidosis severity. Respiration. 76(2): 234-8.
  • Korolenko TA, et al. (2010) Chitotriosidase of human macrophages and mammalian chitinases: biological functions and abnormalities in pathology. Vestn Ross Akad Med Nauk. (11): 39-45.
  • Size / Price
    Каталог: HG11223-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human Chitotriosidase / Chitinase 1 / CHIT1 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.