After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CAMK4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001744.4
Размер кДНК:1422bp
Описание кДНК:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase IV.
Синоним гена:CaMK-GR, MGC36771, CAMK4
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10664-ACGRBS15400
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10664-ACRRBS15400
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10664-ANGRBS15400
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10664-ANRRBS15400
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10664-CFRBS13340
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10664-CHRBS13340
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10664-CMRBS13340
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10664-CYRBS13340
Человек CaM Kinase 4/CaMKIV Джин клон кДНК в вектор клонированияHG10664-MRBS5130
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10664-M-FRBS13340
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмидыHG10664-M-NRBS13340
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10664-NFRBS13340
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10664-NHRBS13340
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10664-NMRBS13340
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10664-NYRBS13340
Человек CaM Kinase 4/CaMKIV Джин ORF экспрессии кДНК клона плазмидыHG10664-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

Ссылки
  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • Size / Price
    Каталог: HG10664-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».