Быстрый заказ

Text Size:AAA

Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CYP3A4 Информация о продукте «Клон cDNA»
Размер кДНК:1512bp
Описание кДНК:Full length Clone DNA of Homo sapiens cytochrome P450, family 3, subfamily A, polypeptide 4 with C terminal His tag.
Синоним гена:HLP, CP33, CP34, CYP3A, NF-25, CYP3A3, P450C3, P450PCN1, MGC126680, CYP3A4
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12043-ACGRBS16760
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12043-ACRRBS16760
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12043-ANGRBS16760
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12043-ANRRBS16760
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12043-CFRBS14710
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12043-CHRBS14710
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12043-CMRBS14710
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12043-CYRBS14710
Человек CYP3A4/Cytochrome P450 3A4 Джин клон кДНК в вектор клонированияHG12043-GRBS5130
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12043-NFRBS14710
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12043-NHRBS14710
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12043-NMRBS14710
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12043-NYRBS14710
Человек CYP3A4/Cytochrome P450 3A4 Джин ORF экспрессии кДНК клона плазмидыHG12043-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12043-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.