Быстрый заказ

Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CYP2J2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC032594
    Размер кДНК:1509bp
    Описание кДНК:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily J, polypeptide 2 with C terminal Flag tag.
    Синоним гена:CPJ2
    Виды:Human
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CYP2J2 qPCR primers for gene expression analysis, HP103710 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15082-ACGRBS16760
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15082-ACRRBS16760
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15082-ANGRBS16760
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15082-ANRRBS16760
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15082-CFRBS14710
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15082-CHRBS14710
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15082-CMRBS14710
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15082-CYRBS14710
    Человек CYP2J2/Cytochrome p450 2J2 Джин клон кДНК в вектор клонированияHG15082-GRBS5130
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15082-NFRBS14710
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15082-NHRBS14710
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15082-NMRBS14710
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15082-NYRBS14710
    Человек CYP2J2/Cytochrome p450 2J2 Джин ORF экспрессии кДНК клона плазмидыHG15082-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15082-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».