Быстрый заказ

Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CYP2D6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000106.4
Размер кДНК:1494bp
Описание кДНК:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6.
Синоним гена:CPD6, CYP2D, CYP2DL1, CYPIID6, P450C2D, P450DB1, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, P450-DB1, MGC120389, MGC120390, CYP2D6
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-CYP2D6
Участок рестрикции:KpnI + XbaI (6.1kb + 1.49kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12022-ACGRBS15400
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12022-ACRRBS15400
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12022-ANGRBS15400
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12022-ANRRBS15400
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12022-CFRBS13340
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12022-CHRBS14710
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12022-CMRBS14710
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12022-CYRBS14710
Человек CYP2D6/Cytochrome P450 2D6 Джин клон кДНК в вектор клонированияHG12022-GRBS5130
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12022-NFRBS13340
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12022-NHRBS13340
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12022-NMRBS13340
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12022-NYRBS13340
Человек CYP2D6/Cytochrome P450 2D6 Джин ORF экспрессии кДНК клона плазмидыHG12022-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12022-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».