Быстрый заказ

Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек CYP1B1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC012049
Размер кДНК:1632bp
Описание кДНК:Full length Clone DNA of Homo sapiens cytochrome P450, family 1, subfamily B, polypeptide 1 with N terminal His tag.
Синоним гена:CP1B, GLC3A, CYPIB1, P4501B1
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CYP1B1 qPCR primers for gene expression analysis, HP103484 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14853-ACGRBS16760
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14853-ACRRBS16760
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14853-ANGRBS16760
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14853-ANRRBS16760
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14853-CFRBS14710
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14853-CHRBS14710
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14853-CMRBS14710
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14853-CYRBS14710
Человек CYP1B1 Джин клон кДНК в вектор клонированияHG14853-GRBS5130
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14853-NFRBS14710
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14853-NHRBS14710
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14853-NMRBS14710
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14853-NYRBS14710
Человек CYP1B1 Джин ORF экспрессии кДНК клона плазмидыHG14853-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14853-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».