Быстрый заказ

Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CXCL2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_002089.3
    Размер кДНК:324bp
    Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 2 with C terminal Myc tag.
    Синоним гена:GRO2, GROb, MIP2, MIP2A, SCYB2, MGSA-b, MIP-2a, CINC-2a
    Виды:Human
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CXCL2 qPCR primers for gene expression analysis, HP100589 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10586-ACGRBS15400
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10586-ACRRBS15400
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10586-CFRBS13340
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10586-CHRBS13340
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10586-CMRBS13340
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10586-CYRBS13340
    Человек CXCL2/MIP-2 Джин клон кДНК в вектор клонированияHG10586-MRBS5130
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10586-M-FRBS13340
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10586-NFRBS13340
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10586-NHRBS13340
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10586-NMRBS13340
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10586-NYRBS13340
    Человек CXCL2/MIP-2 Джин ORF экспрессии кДНК клона плазмидыHG10586-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Chemokine (C-X-C motif) ligand 2 (CXCL2), also called macrophage inflammatory protein 2 (MIP-2), Growth-regulated protein beta (Gro-beta) and Gro oncogene-2 (Gro-2), is a small cytokine belonging to the CXC chemokine family. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for CXCL2/MIP-2 or in the presence of a blocking Ab to CXCL2/MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for MIP-2 (as in CXCR2-deficient mice) or in the presence of a blocking Ab to MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. Understanding the regulation of lymphocyte traffic during tolerance induction may lead to novel therapies for autoimmunity, graft acceptance, and tumor rejection. Several studies have implicated the CXCL2 chemokine as a mediator in the development of sepsis. CXCL2/MIP-2 also plays a major role in mediating the neutrophilic inflammatory response of the rodent lung to particles such as quartz, crocidolite asbestos, as well as high doses of other relative innocuous dusts such as titanium dioxide.

    Ссылки
  • Driscoll KE. (2000) TNFalpha and MIP-2: role in particle-induced inflammation and regulation by oxidative stress. Toxicol Lett. 112-113: 177-83.
  • Walpen S, et al. (2001) Nitric oxide induces MIP-2 transcription in rat renal mesangial cells and in a rat model of glomerulonephritis. FASEB J. 15(3): 571-3.
  • Fahey TJ, et al. (1990) Cytokine production in a model of wound healing: the appearance of MIP-1, MIP-2, cachectin/TNF and IL-1. Cytokine. 2(2): 92-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».