Быстрый заказ

Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

  • Human CXADR natural ORF mammalian expression plasmid, N-Myc tag
ПаспортОбзорыСвязанные продуктыПротоколы
Человек CXADR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001338.3
Размер кДНК:1098bp
Описание кДНК:Full length Clone DNA of Homo sapiens coxsackie virus and adenovirus receptor with N terminal Myc tag.
Синоним гена:CAR, HCAR
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-CXADR
Участок рестрикции:KpnI + XbaI (6kb + 1.13kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CXADR qPCR primers for gene expression analysis, HP100713 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CXADR Gene Plasmid Map
Human CXADR natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10799-ACGRBS15400
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10799-ACRRBS15400
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10799-CFRBS13340
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10799-CHRBS13340
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10799-CMRBS13340
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10799-CYRBS13340
Человек CXADR / CAR Джин клон кДНК в вектор клонированияHG10799-MRBS5130
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10799-NFRBS13340
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10799-NHRBS13340
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10799-NMRBS13340
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10799-NYRBS13340
Человек CXADR / CAR Джин ORF экспрессии кДНК клона плазмидыHG10799-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CXADR (coxsackie virus and adenovirus receptor), also known as CAR, is a type I  transmembrane glycoprotein belonging to the CTX family of the Ig superfamily, and is essential for normal cardiac development in the mouse. Proposed as a homophilic cell adhesion molecule, CXADR is a component of the epithelial apical junction complex that is essential for the tight junction integrity, and probably involved in transepithelial migration of polymorphonuclear leukocytes (PMN). Mature mouse CXADR structrually comprises a 218 aa extracellular domain (ECD) with a V-type (D1) and a C2-type (D2) Ig-like domain, a 21 aa transmembrane segment and a 107 aa intracellular domain, among which,D1 is thought to be responsible for homodimer formation in trans within tight junctions. The ECD of mouse CXADR shares 97%, 90% sequence identity with the corresponding regions of rat, human CXADR.

Ссылки
  • Tomko, R.P. et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94 (7): 3352–3356.
  • van Raaij , M.J. et al., 2001, Structure. 8 (11): 1147–1155.
  • Cohen, C.J. et al., 2001, J. Biol. Chem. 276 (27): 25392–25398.
  • Carson, S.D. et al., 2002, Rev. Med. Virol. 11 (4): 219–226.
  • Selinka, H.C. et al., 2004, Med. Microbiol. Immunol. 193 (2-3): 127–131.
  • Philipson, L. et al., 2004, Curr. Top. Microbiol. Immunol. 273:87-111.
  • Raschperger, E. et al., 2006, Exp. Cell Res. 312: 1566-1580.
  • Size / Price
    Каталог: HG10799-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».