Быстрый заказ

Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CUL5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC063306
    Размер кДНК:2343bp
    Описание кДНК:Full length Clone DNA of Homo sapiens cullin 5.
    Синоним гена:VACM1, VACM-1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CUL5 qPCR primers for gene expression analysis, HP103829 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15203-ACGRBS16760
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15203-ACRRBS16760
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15203-ANGRBS16760
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15203-ANRRBS16760
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15203-CFRBS14710
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15203-CHRBS14710
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15203-CMRBS14710
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15203-CYRBS14710
    Человек Cullin 5 Джин клон кДНК в вектор клонированияHG15203-GRBS5130
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15203-NFRBS14710
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15203-NHRBS14710
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15203-NMRBS14710
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15203-NYRBS14710
    Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмидыHG15203-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15203-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».