After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CUL5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC063306
Размер кДНК:2343bp
Описание кДНК:Full length Clone DNA of Homo sapiens cullin 5.
Синоним гена:VACM1, VACM-1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15203-ACGRBS16760
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15203-ACRRBS16760
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15203-ANGRBS16760
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15203-ANRRBS16760
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15203-CFRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15203-CHRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15203-CMRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15203-CYRBS14710
Человек Cullin 5 Джин клон кДНК в вектор клонированияHG15203-GRBS5130
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15203-NFRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15203-NHRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15203-NMRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15203-NYRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмидыHG15203-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15203-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».