After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CUL5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC063306
Размер кДНК:2343bp
Описание кДНК:Full length Clone DNA of Homo sapiens cullin 5 with N terminal HA tag.
Синоним гена:VACM1, VACM-1
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15203-ACGRBS16760
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15203-ACRRBS16760
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15203-ANGRBS16760
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15203-ANRRBS16760
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15203-CFRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15203-CHRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15203-CMRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15203-CYRBS14710
Человек Cullin 5 Джин клон кДНК в вектор клонированияHG15203-GRBS5130
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15203-NFRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15203-NHRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15203-NMRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15203-NYRBS14710
Человек Cullin 5 Джин ORF экспрессии кДНК клона плазмидыHG15203-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15203-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».