After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CTSZ Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001336.2
Размер кДНК:912bp
Описание кДНК:Full length Clone DNA of Homo sapiens cathepsin Z with N terminal Myc tag.
Синоним гена:CTSZ, CTSX, FLJ17088
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10159-ACGRBS15400
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10159-ACRRBS15400
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10159-CFRBS13340
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10159-CHRBS13340
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10159-CMRBS13340
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10159-CYRBS13340
Человек CTSZ / CTSX / Cathepsin Z Джин клон кДНК в вектор клонированияHG10159-MRBS5130
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10159-NFRBS13340
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10159-NHRBS13340
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10159-NMRBS13340
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10159-NYRBS13340
Человек CTSZ / CTSX / Cathepsin Z Джин ORF экспрессии кДНК клона плазмидыHG10159-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cathepsin Z (CTSZ), also known as Cathepsin X or CATX, belongs to the C1 family of lysosomal cysteine proteases. Its gene structure and activity properties show several unique features that distinguish it clearly from other human cysteine proteases. It has a very short pro-region that shows no similarity to those of other cathepsins and a three-residue insertion motif that forms a characteristic ‘mini loop’. Cathepsin Z exhibits mono- and di-peptidase activity at its C-terminus, and in contrast to cathepsin B, it does not act as an endopeptidase. It is restricted to the cells of theimmune system, predominantly monocytes, macrophages and dendritic cells. Cathepsin Z is widely expressed in human tissues, suggesting that this enzyme could be involved in the normal intracellular protein degradation taking place in all cell types. It is capable to cleave regulatory motifs at C-terminus affecting the function of targeted molecules. Cathepsin X may regulate also the maturation of dendritic cells, a process, which is crucial in the initiation of adaptive immunity. Furthermore, higher levels of Cathepsin Z are also found in tumour and immune cells of prostate and gastric carcinomas and inmacrophages of gastric mucosa, especially after infection by Helicobacter pylori. Cathepsin Z is also ubiquitously distributed in cancer cell lines and in primary tumors from different sources, suggesting that this enzyme may participate in tumor progression.

Ссылки
  • Santamara I, et al. (1998) Cathepsin Z, a novel human cysteine proteinase with a short propeptide domain and a unique chromosomal location. J Biol Chem. 273(27): 16816-23.
  • Kos J, et al. (2009) The role of cathepsin X in cell signaling. Cell Adh Migr. 3(2): 164-6.
  • Sevenich L, et al. (2010) Synergistic antitumor effects of combined cathepsin B and cathepsin Z deficiencies on breast cancer progression and metastasis in mice. Proc Natl Acad Sci U S A. 107(6): 2497-502.
  • Size / Price
    Каталог: HG10159-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».