Cathepsin S cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

Cathepsin S cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
996 bp
Description
Full length Clone DNA of Human cathepsin S with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cathepsin S cDNA ORF Clone, Human, C-HA tag: Alternative Names

CTSS cDNA ORF Clone, Human; MGC3886 cDNA ORF Clone, Human

Cathepsin S Background Information

Cathepsin S (CTSS), one of the lysosomal proteinases, has many important physiological functions in the nervous system, especially in process of extracellular matrix degradation and endocellular antigen presentation. CTSS is synthesized as inactive precursor of 331 amino acids consisting of a 15-aa signal peptide, a propeptide of 99 aa, and a mature polypeptide of 217 aa. It is activated in the lysosomes by a proteolytic cleavage of the propeptide. Cathepsin S is expressed in the lysosome of antigen presenting cells, primarily dendritic cells, B-cells and macrophages. Compared with other lysosomal cysteine proteases, cathepsin S has displayed some unique characteristics. Cathepsin S is most well known for its critical function in the proteolytic digestion of the invariant chain chaperone molecules, thus controlling antigen presentation to CD4+ T-cells by major histocompatibility complex (MHC) class II molecules or to NK1.1+ T-cells via CD1 molecules. Cathepsin S also appears to participate in direct processing of exogenous antigens for presentation by MHC class II to CD4+ T-cells, or in cross-presentation by MHC class I molecules to CD8+ T-cells. In addition, although direct evidence is still lacking, in its secreted form cathepsin S is implicated in degradation of the extracellular matrix, which may contribute to the pathology of a number of diseases, including arthritis, atherosclerosis, neurological diseases and chronic obstructive pulmonary disease.
Full Name
cathepsin S
References
  • Liu W, et al. (2004) Cysteine protease cathepsin S as a key step in antigen presentation. Drug News Perspect. 17(6): 357-63.
  • Thurmond RL, et al. (2005) Cathepsin S inhibitors as novel immunomodulators. Curr Opin Investig Drugs. 6(5): 473-82.
  • Wang DM, et al. (2008) Cathepsin S in pathogenesis of neurological diseases. Zhejiang Da Xue Xue Bao Yi Xue Ban. 37(4): 422-6.

Cathepsin S cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait