Быстрый заказ

Text Size:AAA

Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CTSS Информация о продукте «Клон cDNA»
Размер кДНК:996bp
Описание кДНК:Full length Clone DNA of Homo sapiens cathepsin S with C terminal HA tag.
Синоним гена:MGC3886, CTSS
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10487-ACGRBS15400
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10487-ACRRBS15400
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10487-CFRBS13340
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10487-CHRBS13340
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10487-CMRBS13340
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10487-CYRBS13340
Человек Cathepsin S/CTSS Джин клон кДНК в вектор клонированияHG10487-MRBS5130
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10487-M-FRBS13340
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10487-NFRBS13340
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10487-NHRBS13340
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10487-NMRBS13340
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10487-NYRBS13340
Человек Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмидыHG10487-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cathepsin S (CTSS), one of the lysosomal proteinases, has many important physiological functions in the nervous system, especially in process of extracellular matrix degradation and endocellular antigen presentation. CTSS is synthesized as inactive precursor of 331 amino acids consisting of a 15-aa signal peptide, a propeptide of 99 aa, and a mature polypeptide of 217 aa. It is activated in the lysosomes by a proteolytic cleavage of the propeptide. Cathepsin S is expressed in the lysosome of antigen presenting cells, primarily dendritic cells, B-cells and macrophages. Compared with other lysosomal cysteine proteases, cathepsin S has displayed some unique characteristics. Cathepsin S is most well known for its critical function in the proteolytic digestion of the invariant chain chaperone molecules, thus controlling antigen presentation to CD4+ T-cells by major histocompatibility complex (MHC) class II molecules or to NK1.1+ T-cells via CD1 molecules. Cathepsin S also appears to participate in direct processing of exogenous antigens for presentation by MHC class II to CD4+ T-cells, or in cross-presentation by MHC class I molecules to CD8+ T-cells. In addition, although direct evidence is still lacking, in its secreted form cathepsin S is implicated in degradation of the extracellular matrix, which may contribute to the pathology of a number of diseases, including arthritis, atherosclerosis, neurological diseases and chronic obstructive pulmonary disease.

  • Liu W, et al. (2004) Cysteine protease cathepsin S as a key step in antigen presentation. Drug News Perspect. 17(6): 357-63.
  • Thurmond RL, et al. (2005) Cathepsin S inhibitors as novel immunomodulators. Curr Opin Investig Drugs. 6(5): 473-82.
  • Wang DM, et al. (2008) Cathepsin S in pathogenesis of neurological diseases. Zhejiang Da Xue Xue Bao Yi Xue Ban. 37(4): 422-6.
  • Size / Price
    Каталог: HG10487-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.