After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CTSO Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001334.2
Размер кДНК:966bp
Описание кДНК:Full length Clone DNA of Homo sapiens cathepsin O with N terminal Myc tag.
Синоним гена:CTSO1, CTSO
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11439-ACGRBS15400
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11439-ACRRBS15400
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11439-CFRBS13340
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11439-CHRBS13340
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11439-CMRBS13340
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11439-CYRBS13340
Человек CTSO Gene cDNA clone plasmidHG11439-MRBS5130
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11439-M-FRBS13340
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11439-NFRBS13340
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11439-NHRBS13340
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11439-NMRBS13340
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11439-NYRBS13340
Человек Cathepsin O Джин ORF экспрессии кДНК клона плазмидыHG11439-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11439-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».