Быстрый заказ

Text Size:AAA

Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CTSV Информация о продукте «Клон cDNA»
Размер кДНК:1005bp
Описание кДНК:Full length Clone DNA of Homo sapiens Homo sapiens cathepsin L2 with N terminal His tag.
Синоним гена:CTSL2, CTSU, CTSV, CATL2, MGC125957
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10093-ACGRBS15400
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10093-ACRRBS15400
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10093-CFRBS13340
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10093-CHRBS13340
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10093-CMRBS13340
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10093-CYRBS13340
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин клон кДНК в вектор клонированияHG10093-MRBS5130
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10093-NFRBS13340
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10093-NHRBS13340
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10093-NMRBS13340
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10093-NYRBS13340
Человек Cathepsin V/Cathepsin L2/Preproprotein Джин ORF экспрессии кДНК клона плазмидыHG10093-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cathepsin V (CTSV), also known as Cathepsin L2, CTSL2, and CATL2, is a member of the peptidase C1 family. It is predominantly expressed in the thymus and testis. Cathepsin V is also expressed in corneal epithelium, and to a lesser extent in conjuctival epithelium and skin. It is a lysosomal cysteine proteinase that may play an important role in corneal physiology. It has about 75% protein sequence identity to murine cathepsin L. The fold of this enzyme is similar to the fold adopted by other members of the papain superfamily of cysteine proteases. Cathepsin V has been recently described as highly homologous to Cathepsin L and exclusively expressed in human thymus and testis. Cathepsin V is the dominant cysteine protease in cortical human thymic epithelial cells, while Cathepsin L and Cathepsin S seem to be restricted to dendritic and macrophage-like cells. Active Cathepsin V in thymic lysosomal preparations was demonstrated by active-site labeling. Recombinant Cathepsin V was capable of converting Ii into CLIP efficiently, suggesting that it is the protease that controls the generation of alphabeta-CLIP complexes in the human thymus. Cathepsin V is the third elastolytic cysteine protease which exhibits the most potent elastase activity yet described among human proteases and that it is present in atherosclerotic plaque specimens. Cathepsin L2 may play a specialized role in the thymus and testis. Expression analysis of cathepsin L2 in human tumors revealed a widespread expression in colorectal and breast carcinomas but not in normal colon or mammary gland or in peritumoral tissues. Cathepsin L2 was also expressed by colorectal and breast cancer cell lines as well as by some tumors of diverse origin, including ovarian and renal carcinomas.

  • Itoh R, et al. (1999) Genomic organization and chromosomal localization of the human cathepsin L2 gene. DNA Res. 6(2): 137-40.
  • Tolosa E, et al. (2003) Cathepsin V is involved in the degradation of invariant chain in human thymus and is overexpressed in myasthenia gravis. J Clin Invest. 112(4): 517-26.
  • Yasuda Y, et al. (2004) Cathepsin V, a novel and potent elastolytic activity expressed in activated macrophages. J Biol Chem. 279(35): 36761-70.
  • Puzer L, et al. (2008) Cathepsin V, but not cathepsins L, B and K, may release angiostatin-like fragments from plasminogen. Biol Chem. 389(2): 195-200.
  • Size / Price
    Каталог: HG10093-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.