Cathepsin L cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

Cathepsin L cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1002 bp
Description
Full length Clone DNA of Human cathepsin L1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cathepsin L cDNA ORF Clone, Human, C-HA tag: Alternative Names

CATL cDNA ORF Clone, Human; CTSL cDNA ORF Clone, Human; CTSL1 cDNA ORF Clone, Human; FLJ31037 cDNA ORF Clone, Human; MEP cDNA ORF Clone, Human

Cathepsin L Background Information

Cathepsin L is a lysosomal cysteine protease that plays a major role in intracellular protein catabolism, and is potent in degrading collagen, laminin, elastin, as well as alpha-1 protease inhibitor and other structural proteins of basement membranes. It is secreted by liver flukes at all stages of their development in the mammalian host, are believed to play important roles in facilitating parasite migration (tissue degradation), feeding and immuno-evasion. Like many proteases, Cathepsin L is synthesized as an inactive preproenzyme, and cleavage of the 96-residue proregion is necessary to generate the fully active 221-residue mature enzyme. Studies have demonstrated that cleavage of the proregion occur autocatalytically under acidic conditions. The enzyme takes part in nutrient acquisition by catabolizing host proteins to absorbable peptides, facilitates the migration of the parasite through the host intestine and liver by cleaving interstitial matrix proteins such as fibronectin, laminin and native collagen and is implicated in the inactivation of host immune defenses by cleaving immunoglobulins. Recently, Cathepsin L has been shown to suppress Th1 immune response in infected laboratory animals making them susceptible to concurrent bacterial infections. Cathepsin L is synthesized in large amounts and secreted by many malignantly transformed cells, and induced by growth factors and tumor promoters. In addition to its role in protein degradation, evidence has accumulated for the participation of Cathepsin L in various physiological and pathological processes, such as tumor invasion and metastasis, bone resorption, spermatogenesis, and arthritis. Accordingly, Cathepsin L may prove useful as a diagnostic or prognostic marker of human tumor malignancy.
Full Name
cathepsin L
References
  • Mulcahy G, et al. (2001) Cathepsin L proteinases as vaccines against infection with Fasciola hepatica (liver fluke) in ruminants. Res Vet Sci. 70(1): 83-6.
  • Dixit AK, et al. (2008) Immunodiagnostic/protective role of cathepsin L cysteine proteinases secreted by Fasciola species. Vet Parasitol. 154(3-4): 177-84.
  • Leto G, et al. (2010) Cathepsin L in metastatic bone disease: therapeutic implications. Biol Chem. 391(6): 655-64.

Cathepsin L cDNA ORF Clone, Human, Related Products

Cathepsin L cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait